Mature sequence mmu-miR-34a-5p

Accession numberMIMAT0000542
IDmmu-miR-34a-5p
Previous IDsmmu-miR-34a
Stem-Loop mmu-mir-34a
Sequence
uggcagugucuuagcugguugu
Get sequence
Deep sequencing55682 reads, 104 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12554860 "Numerous microRNPs in neuronal cells containing novel microRNAs" Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G RNA. 9:180-186(2003).
2
PMID:12919684 "Embryonic stem cell-specific MicroRNAs" Houbaviy HB, Murray MF, Sharp PA Dev Cell. 5:351-358(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).