miRBase entry: mmu-mir-34a

Stem-loop mmu-mir-34a


Accession
MI0000584
Symbol
MGI: Mir34a
Description
Mus musculus mmu-mir-34a precursor miRNA mir-34
Gene
family?
RF00456; mir-34

Literature search
388 open access papers mention mmu-mir-34a
(5566 sentences)

Sequence

36318 reads, 514 reads per million, 104 experiments
ccagcugugaguaauucuuUGGCAGUGUCUUAGCUGGUUGUugugaguauuagcuaaggaagcAAUCAGCAAGUAUACUGCCCUagaagugcugcacauugu
.(((.((((((((.((((..(((((((((((.((((((((((...(((....))).....))))))))))))).))))))))..)))).)))).))))))).

Structure
c   c    -    a    uU        -   A          --gug   a 
 cag ugug agua uucu  GGCAGUGU CUU GCUGGUUGUu     agu u
 ||| |||| |||| ||||  |||||||| ||| ||||||||||     |||  
 guu acac ucgu aaga  CCGUCAUA GAA CGACUAAcga     ucg u
u   -    g    g    UC        U   -          aggaa   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
Houbaviy et al. cloned this miRNA from embryonic stem cells and named it miR-172 [1]. This sequence is homologous to human miR-34a (MIR:MI0000268), and so is renamed miR-34a here. This sequence is not related to miR172 from plants (MIR:MI0000215 and MIR:MI0000216). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr4: 150068454-150068555 [+]

Database links

Mature mmu-miR-34a-5p

Accession MIMAT0000542
Description Mus musculus mmu-miR-34a-5p mature miRNA
Sequence 20 - UGGCAGUGUCUUAGCUGGUUGU - 41
Evidence experimental
cloned [1,3], Illumina [4,6]
Database links
Predicted targets

Mature mmu-miR-34a-3p

Accession MIMAT0017022
Description Mus musculus mmu-miR-34a-3p mature miRNA
Sequence 64 - AAUCAGCAAGUAUACUGCCCU - 84
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275