Mature sequence hsa-miR-125a-5p

• Accession number: MIMAT0000443
• ID: hsa-miR-125a-5p
• Previous IDs: hsa-miR-125a
• Stem-Loop: hsa-mir-125a
• Sequence: ucccugagacccuuuaaccuguga
• Deep sequencing: 1146942 reads, 159 experiments
• Database links:
  • RNAcentral:URS00005A4DCF_9606
• Predicted targets:
  • TargetMiner:hsa-miR-125a-5p
  • TargetScanVert:hsa-miR-125a-5p
  • miRDB:hsa-miR-125a-5p
  • microrna.org:hsa-miR-125a-5p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).