Mature sequence hsa-miR-143-3p

• Accession number: MIMAT0000435
• ID: hsa-miR-143-3p
• Previous IDs: hsa-miR-143
• Stem-Loop: hsa-mir-143
• Sequence: ugagaugaagcacuguagcuc
• Deep sequencing: 77597355 reads, 158 experiments
• Database links:
  • RNAcentral:URS00005C2A6D_9606
• Predicted targets:
  • TargetMiner:hsa-miR-143-3p
  • TargetScanVert:hsa-miR-143-3p
  • miRDB:hsa-miR-143-3p
  • microrna.org:hsa-miR-143-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).