Mature sequence hsa-miR-200b-3p

• Accession number: MIMAT0000318
• ID: hsa-miR-200b-3p
• Previous IDs: hsa-miR-200b
• Stem-Loop: hsa-mir-200b
• Sequence: uaauacugccugguaaugauga
• Deep sequencing: 1445603 reads, 157 experiments
• Database links:
  • RNAcentral:URS000014D9C1_9606
• Predicted targets:
  • TargetMiner:hsa-miR-200b-3p
  • TargetScanVert:hsa-miR-200b-3p
  • miRDB:hsa-miR-200b-3p
  • microrna.org:hsa-miR-200b-3p

References

1. PMID:12769849 "Computational and experimental identification of C. elegans microRNAs" Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J Mol Cell. 11:1253-1263(2003).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).