Mature mmu-miR-138-5p
| Accession | MIMAT0000150 |
| Description | mmu-miR-138-5p mature miRNA |
| Hairpins | |
| Sequence | AGCUGGUGUUGUGAAUCAGGCCG |
| Evidence |
experimental
cloned [1,5], Illumina [6-7] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19004786 | has_input UniProtKB:E9PYH0 |
| involved_in | GO:0007162 negative regulation of cell adhesion |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | occurs_in CL:2000058 |
| involved_in | GO:0033689 negative regulation of osteoblast proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19004786 | has_input UniProtKB:E9PYH0 |
| involved_in | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | |
| involved_in | GO:0048387 negative regulation of retinoic acid receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19004786 | has_input UniProtKB:E9PYH0 |
