Comments on: What’s in a name? http://www.mirbase.org/blog/2011/04/whats-in-a-name/ miRBase news and views Thu, 09 May 2013 04:47:03 +0000 hourly 1 http://wordpress.org/?v=3.0.1 By: sam http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-5527 sam Fri, 15 Feb 2013 11:00:14 +0000 http://www.mirbase.org/blog/?p=76#comment-5527 RNAs (like DNA) base-pair in an anti-parallel orientation. So the usual way to draw a miRNA/target pair is something like this: <pre> UTR 5’ G C CC 3’ AC UCUUUA CAUUCCA UG AGAAAU GUAAGGU miRNA 3’ UAUGUA A 5’ </pre> RNAs (like DNA) base-pair in an anti-parallel orientation. So the usual way to draw a miRNA/target pair is something like this:

UTR    5’      G  C      CC        3’
                AC UCUUUA  CAUUCCA
                UG AGAAAU  GUAAGGU
miRNA  3’ UAUGUA  A                5’
]]> By: sam http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-5526 sam Fri, 15 Feb 2013 10:52:03 +0000 http://www.mirbase.org/blog/?p=76#comment-5526 There are several definitions of a family. You allude to one: mature sequences with the same seed are often called a miRNA seed family. However, we use a broader definition more like a standard view of a gene family -- miRNA hairpin sequences that are similar enough to infer that they have evolved from a common ancestor will be members of the same family, and will *usually* get the same number. Since the mature sequences are usually the most conserved parts of a miRNA hairpin, this generally means high sequence similarity between mature sequences. However, sometimes a name choice is a pragmatic call from conflicting evidence. The post in which you've commented explicitly advises that you don't use the names alone to infer complex relationships like this. There are several definitions of a family. You allude to one: mature sequences with the same seed are often called a miRNA seed family. However, we use a broader definition more like a standard view of a gene family — miRNA hairpin sequences that are similar enough to infer that they have evolved from a common ancestor will be members of the same family, and will *usually* get the same number. Since the mature sequences are usually the most conserved parts of a miRNA hairpin, this generally means high sequence similarity between mature sequences. However, sometimes a name choice is a pragmatic call from conflicting evidence. The post in which you’ve commented explicitly advises that you don’t use the names alone to infer complex relationships like this.

]]> By: Mumtaz http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-5511 Mumtaz Mon, 11 Feb 2013 19:33:26 +0000 http://www.mirbase.org/blog/?p=76#comment-5511 We write miRs in 5' to 3' direction regardless whether it is a 3p or 5p miR. Can you please clarify whether all miRs target 3' UTRs in their 5'-3' orientation. Why we see in Tragetscan, for example, UTRs as 5'-3' and miR sequences 3'-5' when in reality miRs are 5'-3'. This question is disturbing me! Your reply is apprecaited We write miRs in 5′ to 3′ direction regardless whether it is a 3p or 5p miR. Can you please clarify whether all miRs target 3′ UTRs in their 5′-3′ orientation. Why we see in Tragetscan, for example, UTRs as 5′-3′ and miR sequences 3′-5′ when in reality miRs are 5′-3′. This question is disturbing me! Your reply is apprecaited

]]> By: Alexis http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-5477 Alexis Mon, 04 Feb 2013 20:45:39 +0000 http://www.mirbase.org/blog/?p=76#comment-5477 Hi Sam, If the miRNA labeled in the miRBase using the same initial name, like miR-166a, b, c, d and so on, can we call them belonging to the same family, the family miR-166? The members of the same family should be identical at nucleotides 2-8, did miRBase follow this to name each individual? Hi Sam,
If the miRNA labeled in the miRBase using the same initial name, like miR-166a, b, c, d and so on, can we call them belonging to the same family, the family miR-166? The members of the same family should be identical at nucleotides 2-8, did miRBase follow this to name each individual?

]]> By: sam http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-5203 sam Mon, 07 Jan 2013 10:55:22 +0000 http://www.mirbase.org/blog/?p=76#comment-5203 miR-34b and miR-34b* are mature sequences from opposite arms of the hairpin precursor. The sequences are very different, so they will have different targets. (As this article says, these sequences are no longer called miR-34b and miR-34b*, rather miR-34b-5p and miR-34b-3p.) The human and mouse sequences are orthologs, but there may be small differences in the sequences between the two species. miR-34b and miR-34b* are mature sequences from opposite arms of the hairpin precursor. The sequences are very different, so they will have different targets. (As this article says, these sequences are no longer called miR-34b and miR-34b*, rather miR-34b-5p and miR-34b-3p.) The human and mouse sequences are orthologs, but there may be small differences in the sequences between the two species.

]]> By: Masood http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-5192 Masood Thu, 03 Jan 2013 20:29:27 +0000 http://www.mirbase.org/blog/?p=76#comment-5192 Hi Mr. Sam. In fact, I am a little bit confused, what is the difference between hsa-miR-34b and hsa-miR-3b*. ? In my study hsa-miR-34b* is highly down-regulated than hsa-miR-34b (about 10 times fold change)? What does that mean? Another question, what is the difference between miR-34b in Human and miR-34b in mouse for example. Hi Mr. Sam.
In fact, I am a little bit confused, what is the difference between hsa-miR-34b and hsa-miR-3b*. ? In my study hsa-miR-34b* is highly down-regulated than hsa-miR-34b (about 10 times fold change)? What does that mean? Another question, what is the difference between miR-34b in Human and miR-34b in mouse for example.

]]> By: math http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-4268 math Tue, 09 Oct 2012 20:15:38 +0000 http://www.mirbase.org/blog/?p=76#comment-4268 many thanks for the clarification! many thanks for the clarification!

]]> By: sam http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-4267 sam Tue, 09 Oct 2012 19:47:07 +0000 http://www.mirbase.org/blog/?p=76#comment-4267 BTW, I think it's useful to think about s/as pairs differently from clustered miRNAs, because s/as pairs cannot be processed from the same transcript. In fact, s/as pairs are special cases that are evolutionarily linked, but not transcriptionally linked. BTW, I think it’s useful to think about s/as pairs differently from clustered miRNAs, because s/as pairs cannot be processed from the same transcript. In fact, s/as pairs are special cases that are evolutionarily linked, but not transcriptionally linked.

]]> By: sam http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-4266 sam Tue, 09 Oct 2012 19:27:59 +0000 http://www.mirbase.org/blog/?p=76#comment-4266 There's no conceptual change in the system here. You can argue this is a marginal case, but the mature sequences do still have significant similarity. From the 5' arms (even though the miR-203a-5p sequence isn't annotated in miRBase -- it should be!), you get this alignment: <code> CAGUGGUUCUUAACAGUUCAACA .||||||.||.||||.||||.|| UAGUGGUCCUAAACAUUUCA.CA </code> That's identical seeds (defined as nts 2-7). The 3' arms don't have identical seeds, but they are similar (and I'm afraid I'm one of those nay-sayers who doesn't buy that the seed is everything): <code> G.UGAAAUGUUUAGGACCACUAGA |.||||.||||.||.||||||.|| GUUGAACUGUUAAGAACCACUGGA </code> I think it's actually pretty tough for sense/antisense pairs to look different enough from each other to warrant different numbers. There’s no conceptual change in the system here. You can argue this is a marginal case, but the mature sequences do still have significant similarity. From the 5′ arms (even though the miR-203a-5p sequence isn’t annotated in miRBase — it should be!), you get this alignment:


CAGUGGUUCUUAACAGUUCAACA
.||||||.||.||||.||||.||
UAGUGGUCCUAAACAUUUCA.CA

That’s identical seeds (defined as nts 2-7). The 3′ arms don’t have identical seeds, but they are similar (and I’m afraid I’m one of those nay-sayers who doesn’t buy that the seed is everything):


G.UGAAAUGUUUAGGACCACUAGA
|.||||.||||.||.||||||.||
GUUGAACUGUUAAGAACCACUGGA

I think it’s actually pretty tough for sense/antisense pairs to look different enough from each other to warrant different numbers.

]]> By: math http://www.mirbase.org/blog/2011/04/whats-in-a-name/#comment-4265 math Tue, 09 Oct 2012 19:16:05 +0000 http://www.mirbase.org/blog/?p=76#comment-4265 thanks Sam. Now I get it. I think. However, I must add that liked the system better when the 'a' and 'b' suffix implied that the two mature miRNAs had identical/very similar seed sequence and hence, (presumably) similar/overlaping functions. I am aware of the fact that this is an oversimplification, still in large-scale expression studies it was always reassuring to see how many times 'a' and 'b' etc. forms are co-regulated. Now the 'a' and 'b' suffix may imply nothing else then physical proximity of the genes encoding them. For example the mature miR-203a and miR-203b does not seem to have a similar seed sequence, as far as I can tell. Because of this, I would say that they belong to one miRNA 'cluster', because of an overlap between the genes encoding their mature forms, but not to the same family, because otherwise they are quite different from each other. With the new system I am still a bit unsure about the difference between miRNA families and miRNA clusters. Anyway, this is only my personal opinion. This is your system, you have the right to decide. thanks Sam. Now I get it. I think.

However, I must add that liked the system better when the ‘a’ and ‘b’ suffix implied that the two mature miRNAs had identical/very similar seed sequence and hence, (presumably) similar/overlaping functions. I am aware of the fact that this is an oversimplification, still in large-scale expression studies it was always reassuring to see how many times ‘a’ and ‘b’ etc. forms are co-regulated. Now the ‘a’ and ‘b’ suffix may imply nothing else then physical proximity of the genes encoding them.

For example the mature miR-203a and miR-203b does not seem to have a similar seed sequence, as far as I can tell. Because of this, I would say that they belong to one miRNA ‘cluster’, because of an overlap between the genes encoding their mature forms, but not to the same family, because otherwise they are quite different from each other. With the new system I am still a bit unsure about the difference between miRNA families and miRNA clusters.

Anyway, this is only my personal opinion. This is your system, you have the right to decide.

]]>