Accession | MIMAT0015048 |
Description | hsa-miR-3173-3p mature miRNA |
Hairpins | |
Sequence | AAAGGAGGAAAUAGGCAGGCCA |
Evidence |
experimental
Illumina [1-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29066351 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29066351 | has_input UniProtKB:Q05397 |
involved_in | GO:0030336 negative regulation of cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:29066351 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29066351 | has_input UniProtKB:Q05397 |