Accession | MIMAT0003888 |
Description | hsa-miR-766-3p mature miRNA |
Hairpins | |
Sequence | ACUCCAGCCCCACAGCCUCAGC |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:1901223 negative regulation of non-canonical NF-kappaB signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
acts_upstream_of | GO:1904465 negative regulation of matrix metallopeptidase secretion |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
acts_upstream_of | GO:2000342 negative regulation of chemokine (C-X-C motif) ligand 2 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
involved_in | GO:0031393 negative regulation of prostaglandin biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
involved_in | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
involved_in | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | has_input UniProtKB:P08235 |
involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
involved_in | GO:0071222 cellular response to lipopolysaccharide |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
involved_in | GO:0071347 cellular response to interleukin-1 |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
involved_in | GO:0071356 cellular response to tumor necrosis factor |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30769772 | |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |