Accession | MIMAT0000516 |
Description | mmu-miR-148a-3p mature miRNA |
Hairpins | |
Sequence | UCAGUGCACUACAGAACUUUGU |
Evidence |
experimental
cloned [2], Illumina [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
involved_in | GO:0010985 negative regulation of lipoprotein particle clearance |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26501192 | |
involved_in | GO:0042632 cholesterol homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26501192 | |
involved_in | GO:0055088 lipid homeostasis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26501192 | |
involved_in | GO:0090370 negative regulation of cholesterol efflux |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26501192 | occurs_in CL:0000235 |