Accession | MIMAT0000391 |
Description | dme-miR-305-5p mature miRNA |
Hairpins | |
Sequence | AUUGUACUUCAUCAGGUGCUCUG |
Evidence |
experimental
cloned [1], 454 [3-4], Illumina [4] |
Database links |
![]() |
Predicted targets |
![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25017064 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25367037 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17714701 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25017064 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25367037 | |
involved_in | GO:0031670 cellular response to nutrient |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25367037 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17714701 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25017064 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25367037 | |
involved_in | GO:0036335 intestinal stem cell homeostasis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25367037 | |
involved_in | GO:0042594 response to starvation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25017064 | |
involved_in | GO:0045747 positive regulation of Notch signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25367037 | |
involved_in | GO:0046627 negative regulation of insulin receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25367037 |