Accession | MIMAT0000332 |
Description | dme-miR-274-5p mature miRNA |
Hairpins | |
Sequence | UUUGUGACCGACACUAACGGGUA |
Evidence |
experimental
Northern [1], 454 [2-3], Illumina [3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31666321 | |
involved_in | GO:0001666 response to hypoxia |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31666321 | |
involved_in | GO:0007424 open tracheal system development |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31666321 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31666321 | |
is_active_in | GO:0043195 terminal bouton |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31666321 |