Accession | MIMAT0000124 |
Description | mmu-miR-15b-5p mature miRNA |
Hairpins | |
Sequence | UAGCAGCACAUCAUGGUUUACA |
Evidence |
experimental
cloned [1-2,4-6], Illumina [7-8] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22379033 | has_input UniProtKB:P01580 |
involved_in | GO:0003300 cardiac muscle hypertrophy |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25103110 | |
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28254819 | |
involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25103110 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22379033 | has_input UniProtKB:P01580 |
involved_in | GO:0045930 negative regulation of mitotic cell cycle |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:21778430 | occurs_in CL:0000746 |
involved_in | GO:1905205 positive regulation of connective tissue replacement |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22052914 | occurs_in UBERON:0000948 |
located_in | GO:0005737 cytoplasm |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25103110 | part_of CL:0000746 |