miRBase entry: nle-mir-378d-1

Stem-loop nle-mir-378d-1


Accession
MI0040202
Description
Nomascus leucogenys nle-mir-378d-1 precursor miRNA


Sequence


ucuguccuuguucuuguugguauuACUGGACUUGGAGUCAGAAG
(((((((..((((..((.......)).))))..)))..))))..

Structure
--    --   uu    uu  ug 
  ucug  ucc  guuc  gu  g
  ||||  |||  ||||  ||  u
  AGAC  AGG  CAGG  CA  a
GA    UG   UU    -U  uu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr20: 78617040-78617083 [-]

Database links

Mature nle-miR-378d

Accession MIMAT0049419
Description Nomascus leucogenys nle-miR-378d mature miRNA
Sequence 25 - ACUGGACUUGGAGUCAGAAG - 44
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 28640911
    Evolution of microRNA in primates
    McCreight JC, Schneider SE, Wilburn DB, Swanson WJ
    PLoS One (2017) 12:e0176596