miRBase entry: mle-mir-125

Stem-loop mle-mir-125


Accession
MI0039563
Description
Melibe leonina mle-mir-125 precursor miRNA


Sequence


UCCCUGAGACCACAAUUUGUGCUcuggcgagCCAGGUUGUGGCCUUAGGAAUC
..((((((.((((((((((.((((....)))))))))))))).))))))....

Structure
--UC      A          U    u 
    CCUGAG CCACAAUUUG GCUc g
    |||||| |||||||||| ||||  
    GGAUUC GGUGUUGGAC Cgag g
CUAA      C          -    c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature mle-miR-125-5p

Accession MIMAT0048749
Description Melibe leonina mle-miR-125-5p mature miRNA
Sequence 1 - UCCCUGAGACCACAAUUUGUGCU - 23
Evidence experimental
Illumina [1]

Mature mle-miR-125-3p

Accession MIMAT0048750
Description Melibe leonina mle-miR-125-3p mature miRNA
Sequence 32 - CCAGGUUGUGGCCUUAGGAAUC - 53
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26473382
    A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome
    "Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ"
    "Annu Rev Genet (2015) 49:213-242