miRBase entry: ocu-mir-451

Stem-loop ocu-mir-451


Accession
MI0039413
Description
Oryctolagus cuniculus ocu-mir-451 precursor miRNA


Sequence


AAACCGUUACCAUUACUGAGUUUaguaaugguaacgguucucuugcuguaccca
.((((((((((((((((......))))))))))))))))...............

Structure
--------------A                GA 
               AACCGUUACCAUUACU  G
               ||||||||||||||||   
               uuggcaaugguaauga  U
acccaugucguucuc                UU 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
CM000808.1: 19330477-19330530 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ocu-mir-451
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ocu-miR-451-5p

Accession MIMAT0048462
Description Oryctolagus cuniculus ocu-miR-451-5p mature miRNA
Sequence 1 - AAACCGUUACCAUUACUGAGUUU - 23
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26733575
    The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference
    "Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D"
    "Genome Biol Evol (2016) 8:330-344