miRBase entry: lja-MIR11135a

Stem-loop lja-MIR11135a


Accession
MI0035889
Description
Lotus japonicus lja-MIR11135a precursor miRNA


Sequence


uauaagcuuauacaauacauuaugaguuuauccauuguuugguaaugacaUUGUAUUGUAUAAGCUUAUCCA
.((((((((((((((((((..(((...(((.(((.....))))))...)))))))))))))))))))))...

Structure
--u                  uu   agu   u   u 
   auaagcuuauacaauaca  aug   uua cca u
   ||||||||||||||||||  |||   ||| ||| g
   UAUUCGAAUAUGUUAUGU  Uac   aau ggu u
ACC                  --   agu   -   u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Chr1: 20361993-20362064 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from lja-MIR11135a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature lja-miR11135a-3p

Accession MIMAT0043904
Description Lotus japonicus lja-miR11135a-3p mature miRNA
Sequence 51 - UUGUAUUGUAUAAGCUUAUCCA - 72
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 25967282
    micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules
    "Holt DB, Gupta V, Meyer D, Abel NB, Andersen SU, Stougaard J, Markmann K"
    "New Phytol (2015) 208:241-256