miRBase entry: gma-MIR862a

Stem-loop gma-MIR862a


Accession
MI0017853
Description
Glycine max gma-MIR862a precursor miRNA

Literature search
4 open access papers mention gma-MIR862a
(6 sentences)

Sequence


agucuucguguucccucaaaggcuuccaguauucauucauaccuaacuaguugcuugaaUGCUGGAUGUCUUUGAAGGAAUuugaaagcu
(((.((((.(((((.((((((((.(((((((((((..((............))..))))))))))).)))))))).))))).)))).)))

Structure
   c    u     c        u           uu  uaccu 
agu uucg guucc ucaaaggc uccaguauuca  ca     a
||| |||| ||||| |||||||| |||||||||||  ||      
ucg aagu UAAGG AGUUUCUG AGGUCGUaagu  gu     a
   a    u     A        U           uc  ugauc 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr18: 57326469-57326558 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from gma-MIR862a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature gma-miR862a

Accession MIMAT0021004
Description Glycine max gma-miR862a mature miRNA
Sequence 60 - UGCUGGAUGUCUUUGAAGGAAU - 81
Evidence experimental
454 [1], SOLiD [2], Illumina [3-4]

References

  1. PubMed ID: 21663675
    Identification of novel soybean microRNAs involved in abiotic and biotic stresses
    Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
    BMC Genomics (2011) 12:307

  2. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  3. PubMed ID: 21751852
    Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome
    "Radwan O, Liu Y, Clough SJ"
    "Mol Plant Microbe Interact (2011) 24:958-972

  4. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153