miRBase entry: bfl-mir-4905

Stem-loop bfl-mir-4905


Accession
MI0017682
Description
Branchiostoma floridae bfl-mir-4905 precursor miRNA


Sequence


aguagaauUAUGUGGAAGAUAUUUUAGAAUuguuugggucauauuuagcauuucuggacuuccauauauuacuuga
(((((...((((((((((....(((((((.((((............)))).))))))))))))))))))))))...

Structure
---     aau          AUAU       U    ugggu 
   aguag   UAUGUGGAAG    UUUAGAA uguu     c
   |||||   ||||||||||    ||||||| ||||      
   ucauu   auauaccuuc    aggucuu acga     a
agu     ---          ----       u    uuuau 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
GG666603.1: 3650297-3650372 [-]

Database links

Mature bfl-miR-4905

Accession MIMAT0020501
Description Branchiostoma floridae bfl-miR-4905 mature miRNA
Sequence 9 - UAUGUGGAAGAUAUUUUAGAAU - 30
Evidence experimental
454 [1]

References

  1. PubMed ID: 21210939
    microRNA complements in deuterostomes: origin and evolution of microRNAs
    "Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M"
    "Evol Dev (2011) 13:15-27