miRBase entry: ppy-mir-936

Stem-loop ppy-mir-936


Accession
MI0015171
Description
Pongo pygmaeus ppy-mir-936 precursor miRNA


Sequence


ucaaggccgcugggACAAUAGAGGGAGGAAUCACAGaaaucacuccaggagcaacugagagaccuuacuucuacuuuaccagguccugcuggcccaga
....((((((.(((((..((((((((((..((.(((...((.......))....))).))..)))).)))))).........))))))).))))....

Structure
ucaa    -  u     -------AA      -    AA  A   -aaa  ac 
    ggcc gc gggAC         UAGAGG GAGG  UC CAG    uc  u
    |||| || |||||         |||||| ||||  || |||    ||  c
    ccgg cg uccug         aucuuc uucc  ag guc    ag  c
agac    u  -     gaccauuuc      a    ag  a   aacg  ga 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 103143697-103143794 [-]

Database links

Mature ppy-miR-936

Accession MIMAT0016136
Description Pongo pygmaeus ppy-miR-936 mature miRNA
Sequence 15 - ACAAUAGAGGGAGGAAUCACAG - 36
Evidence not_experimental

References

  1. PubMed ID: 20214803
    Genome-wide comparative analysis of microRNAs in three non-human primates
    Brameier M
    BMC Res Notes (2010) 3:64