miRBase entry: hsv2-mir-H12

Stem-loop hsv2-mir-H12


Accession
MI0013899
Description
Herpes Simplex Virus 2 hsv2-mir-H12 precursor miRNA


Sequence


gggcgccagugcucgcacuuugcccuaauaauauauauacuaUUAGGACGAAGUGCGAACGCUUcgcguuc
((((((.((((.((((((((((.(((((((..........))))))).)))))))))).))))..))))))

Structure
      -c    c          c       auau 
gggcgc  agug ucgcacuuug ccuaaua    a
||||||  |||| |||||||||| |||||||     
cuugcg  UCGC AGCGUGAAGC GGAUUau    u
      cU    A          A       caua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature hsv2-miR-H12

Accession MIMAT0014699
Description Herpes Simplex Virus 2 hsv2-miR-H12 mature miRNA
Sequence 43 - UUAGGACGAAGUGCGAACGCUU - 64
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20181707
    Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2
    "Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM"
    "J Virol (2010) 84:4659-4672