miRBase entry: bta-mir-2284d

Stem-loop bta-mir-2284d


Accession
MI0011335
Description
Bos taurus bta-mir-2284d precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

bta-mir-2284d, a bovine-specific microRNA, exhibits a negative correlation with various transcripts in the distal jejunum, such as the DE gene F3 and PTGS2, which are implicated in immune responses and leukocyte recruitment [PMC7959717]. In the duodenum, bta-mir-2284d is inversely associated with MYC and NLK transcripts that are linked to lymphoid tissue structure and development [PMC7959717]. Despite its identification in multiple bovine miRNA studies, detailed functional information about bta-mir-2284d remains limited [PMC7959717]. The down-regulation of bta-mir-2284d in super-shedders (SS) suggests its potential role in modulating immune functions and lipid metabolism within the intestinal tract, which may affect E. coli O157 interactions [PMC7959717'>PMC7959717]. The miRNA is also associated with hematological system development and function as indicated by enriched negatively correlated target transcripts [PMC7959717]. Intriguingly, bta-mir-2284d is located within an intron of the SWAP70 gene [PMC7959717], and its down-regulation across multiple intestinal regions of SS cattle suggests a broader impact on host-pathogen dynamics that could influence super-shedding phenomena [PMC7959717].

Literature search
13 open access papers mention bta-mir-2284d
(32 sentences)

Sequence

394 reads, 13 reads per million, 8 experiments
ugaguugaccAAAAAGUUCGUUAGGGUUUUUCuucaagcucuuacgggaaaacucgaacaaaccuuuuguccaaccca
((.((((..(((((.(((.(((.((((((((((............)))))))))).))).))).)))))..)))).))

Structure
  a    ac     A   C   A          ucaag 
ug guug  cAAAA GUU GUU GGGUUUUUCu     c
|| ||||  ||||| ||| ||| ||||||||||      
ac caac  guuuu caa caa cucaaaaggg     u
  c    cu     c   a   g          cauuc 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr15: 43745466-43745543 [-]

Database links

Mature bta-miR-2284d

Accession MIMAT0011836
Description Bos taurus bta-miR-2284d mature miRNA
Sequence 11 - AAAAAGUUCGUUAGGGUUUUUC - 32
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 19633723
    Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection
    Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ
    PLoS One (2009) 4:e6349