miRBase entry: bra-MIR167d

Stem-loop bra-MIR167d


Accession
MI0010655
Description
Brassica rapa bra-MIR167d precursor miRNA

Literature search
9 open access papers mention bra-MIR167d
(37 sentences)

Sequence


ggcgcaccggcaucugaUGAAGCUGCCAGCAUGAUCUAauuaucuuucuuucucuguugacgauggaaaagacaugaguguugauuagaucauguucgcaguuucacccguugacugucucgcc
((((...(((((.(.(.(((((((((.(((((((((((((((.((((((((.((((((...)))))))))))...)))...))))))))))))))).))))))))).).).)).)))...))))

Structure
    cac   -  u u a         C               --u   ---     c      g 
ggcg   cgg ca c g UGAAGCUGC AGCAUGAUCUAauua   cuu   ucuuu ucuguu  
||||   ||| || | | ||||||||| |||||||||||||||   |||   ||||| |||||| a
ccgc   guc gu g c acuuugacg uuguacuagauuagu   gag   agaaa agguag  
    ucu   a  u c c         c               ugu   uac     -      c 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature bra-miR167d

Accession MIMAT0010160
Description Brassica rapa bra-miR167d mature miRNA
Sequence 18 - UGAAGCUGCCAGCAUGAUCUA - 38
Evidence experimental
cloned [1], Northern [1]

References

  1. PubMed ID: 18558089
    Characterization of conserved and novel microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R gene-derived novel miRNA in Brassica
    "He XF, Fang YY, Feng L, Guo HS"
    "FEBS Lett (2008) 582:2445-2452