miRBase entry: bra-MIR167b

Stem-loop bra-MIR167b


Accession
MI0010653
Description
Brassica rapa bra-MIR167b precursor miRNA

Literature search
10 open access papers mention bra-MIR167b
(38 sentences)

Sequence


gguguacaggcaucugaUGAAGCUGCCAGCAUGAUCUAauuaacuuucuuucucuguugauuuuaugacaauggaaaagagaugagugucgauuagaucauguucgcaguuucacccauugacugucgcacc
(((((((((.((...(.(((((((((.((((((((((((((.(((((((((.(((((((.((....)))))))))..))))).))))...)))))))))))))).))))))))).)...)).)))).)))))

Structure
     -    g  ucu a         C              --a    -     -c       a  u 
ggugu acag ca   g UGAAGCUGC AGCAUGAUCUAauu   acuu ucuuu  ucuguug uu u
||||| |||| ||   | ||||||||| ||||||||||||||   |||| |||||  ||||||| ||  
ccacg uguc gu   c acuuugacg uuguacuagauuag   ugag agaga  agguaac ag a
     c    a  uac c         c              cug    u     aa       -  u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chrA1: 19998656-19998787 [-]

Database links

Mature bra-miR167b

Accession MIMAT0010158
Description Brassica rapa bra-miR167b mature miRNA
Sequence 18 - UGAAGCUGCCAGCAUGAUCUA - 38
Evidence experimental
cloned [1], Northern [1]

References

  1. PubMed ID: 18558089
    Characterization of conserved and novel microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R gene-derived novel miRNA in Brassica
    "He XF, Fang YY, Feng L, Guo HS"
    "FEBS Lett (2008) 582:2445-2452

  2. PubMed ID: 24559317
    Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis
    Jiang J, Lv M, Liang Y, Ma Z, Cao J
    BMC Genomics (2014) 15:146