Stem-loop ssc-mir-16-2

Accession

MI0008212

Description

Sus scrofa ssc-mir-16-2 precursor miRNA

Literature search

21 open access papers mention ssc-mir-16-2
(45 sentences)

Sequence

433 reads, 127 reads per million, 12 experiments

cagugccuUAGCAGCACGUAAAUAUUGGCGuuaagauucuaaaauuaucuccaguauuaacugugcugcugaaguaagg
...(((.((((((((((((.((((((((.(.(((..........))).).)))))))).)).)))))))))).)))...

Structure

cag   c          -  A        C u   gauu 
   ugc uUAGCAGCAC GU AAUAUUGG G uaa    c
   ||| |||||||||| || |||||||| | |||     
   aug agucgucgug ca uuaugacc c auu    u
gga   a          u  a        u u   aaaa 

Annotation confidence Not enough data

Genome context

chrUScaf2048: 70557-70635 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from ssc-mir-16-2

Mature ssc-miR-16

• Accession: MIMAT0007754
• Description: Sus scrofa ssc-miR-16 mature miRNA
• Sequence: 9 - UAGCAGCACGUAAAUAUUGGCG - 30
• Evidence: experimental ; cloned [1,3], Illumina [2,4-5]

References

1. PubMed ID: 19917043
   MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
   "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
   "Anim Genet (2010) 41:159-168


2. PubMed ID: 20180025
   Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
   "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
   "Mol Biol Rep (2010) 37:3567-3574


3. PubMed ID: 18548309
   Identification and characterization of new microRNAs from pig
   "Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS"
   "Mamm Genome (2008) 19:570-580


4. PubMed ID: 21312241
   MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
   "Li G, Li Y, Li X, Ning X, Li M, Yang G"
   "J Cell Biochem (2011) 112:1318-1328


5. PubMed ID: 24499489
   Exploration of microRNAs in porcine milk exosomes
   Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
   BMC Genomics (2014) 15:100