miRBase entry: hsa-mir-1180

Stem-loop hsa-mir-1180


Accession
MI0006273
Symbol
HGNC: MIR1180
Description
Homo sapiens hsa-mir-1180 precursor miRNA
Gene family
MIPF0000789; mir-1180

Literature search
9 open access papers mention hsa-mir-1180
(84 sentences)

Sequence

7979 reads, 215 reads per million, 153 experiments
gcugcuGGACCCACCCGGCCGGGAAUAgugcuccugguugUUUCCGGCUCGCGUGGGUGUGUcggcggc
((((((((((((((.(((((((((((((..(....).))))))))))).)).))))))...))))))))

Structure
        ---      C  -           ug u 
gcugcuGG   ACCCAC CG GCCGGGAAUAg  c c
||||||||   |||||| || |||||||||||  |  
cggcggcU   UGGGUG GC CGGCCUUUguu  g c
        GUG      C  U           -g u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr17: 19344506-19344574 [-]

Database links

Mature hsa-miR-1180-3p

Accession MIMAT0005825
Description Homo sapiens hsa-miR-1180-3p mature miRNA
Sequence 41 - UUUCCGGCUCGCGUGGGUGUGU - 62
Evidence experimental
cloned [1], 454 [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-1180-5p

Accession MIMAT0026735
Description Homo sapiens hsa-miR-1180-5p mature miRNA
Sequence 7 - GGACCCACCCGGCCGGGAAUA - 27
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 19508715
    Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing
    Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T
    BMC Med Genomics (2009) 2:35

  2. PubMed ID: 17922033
    MicroRNA expression signature of human sarcomas
    "Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M"
    "Oncogene (2008) 27:2015-2026

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45