Accession
MI0005454
Description
Bos taurus
bta-let-7c precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Bta-let-7c is a member of the let-7 family of microRNAs, which are small, non-coding RNA molecules involved in the regulation of gene expression [PMC5999645]. This microRNA was found to be significantly upregulated in placental exosomes compared to non-pregnant exosomes, indicating a potential role in pregnancy [PMC5999645]. Bta-let-7c expression was also significantly altered by exosome treatment, suggesting its involvement in cellular communication [PMC5999645]. Furthermore, bta-let-7c has been implicated in the regulation of inflammatory responses as its overexpression can decrease the expression of proinflammatory cytokines and NRAS [PMC5999645]. It has been observed to be upregulated following LPS challenge in bubaline PBMCs and mice whole blood, which may indicate a role in immune responses [PMC4892552]. Bta-let-7c is also among the most abundant miRNAs across various developmental stages and is considered an important nutritional component of milk across different species [PMC7073773; PMC7191744].. It may regulate glycerophospholipid metabolism by inhibiting enzymes involved in triglyceride synthesis and degradation [PMC5341059]. Despite its emerging significance, further research is needed to fully understand bta-let-7c's role during bovine mastitis and other conditions affecting cattle health [PMC7937231].
Literature search
52 open access papers mention bta-let-7c
(234 sentences)
(234 sentences)
Sequence
243137
reads,
1399
reads per million, 76 experiments
gcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacacccugggaguuaacuguacaaccuucuagcuuuccuuggagc
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))
Structure
a uU G U ua g ua c gc uccggg GAG UAG AGGUUGUAUGGUU ga u ca || |||||| ||| ||| ||||||||||||| || | || c cg agguuc uuc auc uccaacaugucaa uu a gu - cu g u -- g gg c
Annotation confidence
High
Do you think this miRNA is real?
Genome context
chr1: 19984844-19984927 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-let-7c
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Database links
Mature bta-let-7c
| Accession | MIMAT0004332 |
| Description | Bos taurus bta-let-7c mature miRNA |
| Sequence | 11 - UGAGGUAGUAGGUUGUAUGGUU - 32 |
| Evidence |
experimental
cloned [1] |
References
|
