miRBase entry: ath-MIR775

Stem-loop ath-MIR775


Accession
MI0005105
Description
Arabidopsis thaliana ath-MIR775 precursor miRNA

Literature search
7 open access papers mention ath-MIR775
(40 sentences)

Sequence


uuuaaacguugcacuacgugacauugaaacugucuuucaacauuccaauauuucaacuuucgaauacccaauauuugguuuguucaaagacauuUUCGAUGUCUAGCAGUGCCAauguuuaaa
.((((((((((((((.(..((((((((((.(((((((.((((..((((..........................))))..)))).))))))).))))))))))..).)))).)))))))))).

Structure
u          -    a gu          c       c    uu    uauuucaacuuu 
 uuaaacguug cacu c  gacauugaaa ugucuuu aaca  ccaa            c
 |||||||||| |||| |  |||||||||| ||||||| ||||  ||||             
 aauuuguaAC GUGA G  CUGUAGCUUu acagaaa uugu  gguu            g
a          C    C AU          u       c    uu    uauaacccauaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 29422452-29422574 [+]

Database links

Mature ath-miR775

Accession MIMAT0003934
Description Arabidopsis thaliana ath-miR775 mature miRNA
Sequence 95 - UUCGAUGUCUAGCAGUGCCA - 114
Evidence experimental
MPSS [1], Northern [1,3], 454 [2-3], cloned [2], Illumina [4]

References

  1. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  2. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  3. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  4. PubMed ID: 17299599
    High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes
    Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC
    PLoS One (2007) 2:e219