bta-mir-34c is a microRNA (miRNA) that has been identified as differentially expressed in bovine sperm, with its expression being significantly downregulated in frozen sperm compared to fresh sperm [PMC7214931]. It has been validated through RT-qPCR as one of the miRNAs with altered expression, confirming the results of high-throughput sequencing [PMC6876490]. bta-mir-34c is predicted to bind to and regulate the expression of genes such as DDIT4, which is involved in cancer progression and angiogenesis [PMC6876490]. It shares common targets with bta-miR-449b, including genes like PYCR1 and DDIT4, suggesting a role in cellular transformation induced by BPV E5 [PMC6876490]. The miRNA is also implicated in the regulation of spermatogenesis, promoting the transition from mitosis to meiosis and maintaining spermatogenic cell numbers [PMC9785434]. However, its expression was found to be downregulated under metabolic stress conditions in cows and differentially expressed during various stages of the estrous cycle [PMC6731312], [PMC4156418]. Furthermore, bta-mir-34c has been shown to target multiple genes that are important for cell cycle regulation when overexpressed by transfection into spermatogonia [PMC6949159], indicating its potential regulatory role in bovine fertility processes [PMC9113469].
a ag A A A C c a gucu uuacu GGC GUGU GUUAG UGAUUG ua u |||| ||||| ||| |||| ||||| |||||| || uaga aaugg ccg caca caauc acuaac au a u aa a g c - c a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0003854 |
Description | Bos taurus bta-miR-34c mature miRNA |
Sequence | 13 - AGGCAGUGUAGUUAGCUGAUUG - 34 |
Evidence |
experimental
cloned [1], Array [2], qRT-PCR [2] |
|