Accession
MI0004991
Description
Epstein Barr virus
ebv-mir-BART18 precursor miRNA
Sequence
uuguugccguugaaagacggguguccuggcUCAAGUUCGCACUUCCUAUACAguguuaaagccuugUAUCGGAAGUUUGGGCUUCGUCccaguguacucgauaaugucgacugcugcga
((((.((.(((((....((((((.(((((..((((((((.((((((.((((((.((....)).)))))).)))))).))))))).)..)))).)))))))......))))).)).))))
((((.((.(((((....((((((.(((((..((((((((.((((((.((((((.((....)).)))))).)))))).))))))).)..)))).)))))))......))))).)).))))
Structure
u c --aaga u - cU - C U u u
uugu gc guuga cgggug c cugg C AAGUUCG ACUUCC AUACAg gu a
|||| || ||||| |||||| | |||| | ||||||| |||||| |||||| ||
agcg cg cagcu gcucau g gacc G UUCGGGU UGAAGG UAUguu cg a
u u guaaua - u CU C U C c a
Annotation confidence
Not enough data
Do you think this miRNA is real?
Comments
The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART10 by Grundhoff et al [1] but is not related to ebv-miR-BART10 (MIR:MI0003732). The mature miRNA names and sequences reflect cloning frequencies from Landgraf et al. [2], and may differ subtly from previous annotations.
Genome context
HHV507799: 145932-146050 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART18
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
ebv-mir-BART18 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature ebv-miR-BART18-5p
| Accession | MIMAT0003717 |
| Description | Epstein Barr virus ebv-miR-BART18-5p mature miRNA |
| Sequence | 31 - UCAAGUUCGCACUUCCUAUACA - 52 |
| Evidence |
experimental
array [1], Northern [1], cloned [2] |
Mature ebv-miR-BART18-3p
| Accession | MIMAT0004835 |
| Description | Epstein Barr virus ebv-miR-BART18-3p mature miRNA |
| Sequence | 67 - UAUCGGAAGUUUGGGCUUCGUC - 88 |
| Evidence |
experimental
cloned [2] |
References
|
