miRBase entry: bta-mir-29a

Stem-loop bta-mir-29a


Accession
MI0004733
Description
Bos taurus bta-mir-29a precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

bta-mir-29a, a microRNA, is notably expressed at higher levels in the adult bovine ovarian cortex compared to the fetal ovary, indicating a potential role in ovarian function and development [PMC2762473]. This microRNA was chosen for cellular localization studies due to its differential expression, suggesting its significance in reproductive tissues [PMC2762473]. Additionally, bta-mir-29a is among the miRNAs differentially expressed in bovine milk and plasma during early pregnancy [PMC6418173], and it has been implicated in processes related to pregnancy maintenance and immune function [PMC9445238]. Its stability has led to its proposed use as an internal control for normalizing qPCR data in studies involving bovine milk small extracellular vesicles (sEVs) [PMC9961204]. Network analysis further associates bta-mir-29a with key uterine proteins, indicating a strong interaction with reproductive processes at the molecular level [PMC8273763]. Despite variable expression patterns observed under different conditions, bta-mir-29a's consistent association with reproductive tissues underscores its potential as a biomarker for reproductive status and health in cattle [PMC5662615], while also being inversely correlated with lysosomal activity suggesting an involvement in cellular processes beyond reproduction [PMC9378797].

Literature search
31 open access papers mention bta-mir-29a
(133 sentences)

Sequence

151250 reads, 759 reads per million, 76 experiments
augacugauuucuuuugguguucagagucaauauaauuuuCUAGCACCAUCUGAAAUCGGUUAu
((((((((((((...(((((((.((((...........)))))))))))...))))))))))))

Structure
            uuu       c    ucaa 
augacugauuuc   ugguguu agag    u
||||||||||||   ||||||| ||||    a
uAUUGGCUAAAG   ACCACGA UCuu    u
            UCU       -    uuaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr4: 95726868-95726931 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-mir-29a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bta-miR-29a

Accession MIMAT0003518
Description Bos taurus bta-miR-29a mature miRNA
Sequence 41 - CUAGCACCAUCUGAAAUCGGUUA - 63
Evidence experimental
cloned [1-2]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43

  2. PubMed ID: 17306260
    Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland
    "Gu Z, Eleswarapu S, Jiang H"
    "FEBS Lett (2007) 581:981-988