Stem-loop mmu-mir-500

Accession

MI0004702

Symbol

MGI: Mir500

Description

Mus musculus mmu-mir-500 precursor miRNA mir-500

Gene
family

RF01903; mir-500

Literature search

6 open access papers mention mmu-mir-500
(9 sentences)

Sequence

15961 reads, 189 reads per million, 103 experiments

cuccucugcucccccucucuAAUCCUUGCUAUCUGGGUGCUUAGUgcuaucucaaugcAAUGCACCUGGGCAAGGGUUCAgagaaggugagc
.......((((.((.((((((((((((((...((((((((....(((.........)))..))))))))))))))))).))))).)).))))

Structure

cuccucu    c  c     -         UAU        UUAG   uau 
       gcuc cc ucucu AAUCCUUGC   CUGGGUGC    Ugc   c
       |||| || ||||| |||||||||   ||||||||    |||   u
       cgag gg agagA UUGGGAACG   GGUCCACG    Acg   c
-------    u  a     C         ---        --UA   uaa 

Annotation confidence High

Comments

Mouse miR-500 was identified independently by two groups. Wheeler et al cloned a mature product with the same length as the human ortholog (MIR:MI0003184) [1]. Mineno et al report a shorter mature product with 1 additional base at the 5' end and 3 fewer at the 3' end (AAUGCACCUGGGCAAGGGUU), referred to as miR-500b in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chrX: 7237683-7237774 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from mmu-mir-500

Mature mmu-miR-500-5p

• Accession: MIMAT0017258
• Description: Mus musculus mmu-miR-500-5p mature miRNA
• Sequence: 21 - AAUCCUUGCUAUCUGGGUGCUUAGU - 45
• Evidence: experimental ; 454 [5], Illumina [6]

Mature mmu-miR-500-3p

• Accession: MIMAT0003507
• Description: Mus musculus mmu-miR-500-3p mature miRNA
• Sequence: 59 - AAUGCACCUGGGCAAGGGUUCA - 80
• Evidence: experimental ; cloned [1,3], insitu [1], Northern [1], MPSS [2], Illumina [4,6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275


5. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771


6. PubMed ID: 16566924
   Identification of new central nervous system specific mouse microRNAs
   "Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T"
   "FEBS Lett (2006) 580:2195-2200