miRBase entry: mmu-mir-708

Stem-loop mmu-mir-708


Accession
MI0004692
Symbol
MGI: Mir708
Description
Mus musculus mmu-mir-708 precursor miRNA mir-708
Gene
family?
RF00917; mir-708

Literature search
28 open access papers mention mmu-mir-708
(210 sentences)

Sequence

68074 reads, 780 reads per million, 88 experiments
cuguguuugaaauggggacugcccucAAGGAGCUUACAAUCUAGCUGGGgguagaugacuugcacuugaacaCAACUAGACUGUGAGCUUCUAGagggcaggggccuua
.............(((..((((((((.(((((((((((.(((((.((.(..(((.((.....)).)))..).)).))))).))))))))))).))))))))...)))..

Structure
cuguguuugaaau   -ga        A           A     C  G gg   a  a 
             ggg   cugcccuc AGGAGCUUACA UCUAG UG G  uag ug c
             |||   |||||||| ||||||||||| ||||| || |  ||| || u
             ucc   gacgggaG UCUUCGAGUGU AGAUC AC c  guu ac u
-----------au   ggg        A           C     A  a aa   c  g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr7: 96249424-96249532 [+]

Database links

Mature mmu-miR-708-5p

Accession MIMAT0004828
Description Mus musculus mmu-miR-708-5p mature miRNA
Sequence 27 - AAGGAGCUUACAAUCUAGCUGGG - 49
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-708-3p

Accession MIMAT0003498
Description Mus musculus mmu-miR-708-3p mature miRNA
Sequence 73 - CAACUAGACUGUGAGCUUCUAG - 94
Evidence experimental
MPSS [1], miRAP-cloned [2], cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115