miRBase entry: mmu-mir-673

Stem-loop mmu-mir-673


Accession
MI0004601
Symbol
MGI: Mir673
Description
Mus musculus mmu-mir-673 precursor miRNA mir-673
Gene
family?
RF00922; mir-673

Literature search
9 open access papers mention mmu-mir-673
(10 sentences)

Sequence

26073 reads, 442 reads per million, 66 experiments
uggagccugaggggCUCACAGCUCUGGUCCUUGGAGcuccagagaaaauguugcUCCGGGGCUGAGUUCUGUGCACCccccuugcccucca
(((((..(((((((..(((((..((.(.(((((((((..((.......))..))))))))).).))..)))))....)))))))..)))))

Structure
     cc       --CU     CU  G U         uc  ga 
uggag  ugagggg    CACAG  CU G CCUUGGAGc  ca  g
|||||  |||||||    |||||  || | |||||||||  ||  a
accuc  guucccc    GUGUC  GA U GGGGCCUcg  gu  a
     cc       CCAC     UU  G C         uu  aa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr12: 109571990-109572080 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-673
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-673-5p

Accession MIMAT0003739
Description Mus musculus mmu-miR-673-5p mature miRNA
Sequence 15 - CUCACAGCUCUGGUCCUUGGAG - 36
Evidence experimental
MPSS [1], cloned [2,4], miRAP-cloned [3], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-673-3p

Accession MIMAT0004824
Description Mus musculus mmu-miR-673-3p mature miRNA
Sequence 55 - UCCGGGGCUGAGUUCUGUGCACC - 77
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115

  6. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298