miRBase entry: ebv-mir-BART6

Stem-loop ebv-mir-BART6


Accession
MI0003728
Description
Epstein Barr virus ebv-mir-BART6 precursor miRNA


Sequence


ugaccuuguugguacuuUAAGGUUGGUCCAAUCCAUAGGcuuuuuuugugaaaaccCGGGGAUCGGACUAGCCUUAGAguaacucaaggcca
...(((((....(((((((((((((((((.((((...((.(((((....))))).))..)))).)))))))))))))))))...)))))...

Structure
uga     uugg                 A    AUA  c     u 
   ccuug    uacuuUAAGGUUGGUCC AUCC   GG uuuuu u
   |||||    ||||||||||||||||| ||||   || |||||  
   ggaac    augAGAUUCCGAUCAGG UAGG   Cc aaaag g
acc     -uca                 C    -GG  c     u 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
mir-BART6 was discovered independently by two groups. Cai et al identified a mature miRNA product from the 3' arm of the hairpin precursor and mapped the ends of the mature sequence by cloning [1]. Grundhoff et al report that the 5' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence was misnamed miR-BART9 in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
HHV507799: 140016-140107 [+]
Clustered miRNAs
20 other miRNAs are < 10 kb from ebv-mir-BART6
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART6 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART6-5p

Accession MIMAT0003414
Description Epstein Barr virus ebv-miR-BART6-5p mature miRNA
Sequence 18 - UAAGGUUGGUCCAAUCCAUAGG - 39
Evidence experimental
array [2], Northern [2], cloned [3]

Mature ebv-miR-BART6-3p

Accession MIMAT0003415
Description Epstein Barr virus ebv-miR-BART6-3p mature miRNA
Sequence 57 - CGGGGAUCGGACUAGCCUUAGA - 78
Evidence experimental
cloned [1,3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16557291
    Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
    Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
    PLoS Pathog (2006) 2:e23

  3. PubMed ID: 16540699
    A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
    "Grundhoff A, Sullivan CS, Ganem D"
    "RNA (2006) 12:733-750