Stem-loop mmu-mir-494

Accession

MI0003532

Symbol

MGI: Mir494

Description

Mus musculus mmu-mir-494 precursor miRNA

Literature search

67 open access papers mention mmu-mir-494
(740 sentences)

Sequence

15792 reads, 216 reads per million, 83 experiments

uugauacuugaaggagAGGUUGUCCGUGUUGUCUUCUCuuuauuuaugaUGAAACAUACACGGGAAACCUCuuuuuuaguaucaa
.(((((((.((((((((((((.((((((((((.(((((.........)).)))))).))))))).))))))))))))))))))).

Structure

u       u            G       -   C   -  uuu 
 ugauacu gaaggagAGGUU UCCGUGU UGU UUC UC   a
 ||||||| |||||||||||| ||||||| ||| ||| ||   u
 acuauga uuuuuuCUCCAA GGGCACA ACA AAG ag   u
a       -            A       U   -   U  uau 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr12: 109715318-109715402 [+]

Clustered miRNAs

20 other miRNAs are < 10 kb from mmu-mir-494

Mature mmu-miR-494-5p

• Accession: MIMAT0017215
• Description: Mus musculus mmu-miR-494-5p mature miRNA
• Sequence: 17 - AGGUUGUCCGUGUUGUCUUCUC - 38
• Evidence: experimental ; Illumina [5]

Mature mmu-miR-494-3p

• Accession: MIMAT0003182
• Description: Mus musculus mmu-miR-494-3p mature miRNA
• Sequence: 50 - UGAAACAUACACGGGAAACCUC - 71
• Evidence: experimental ; cloned [1,3], MPSS [2], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267