miRBase entry: mmu-mir-543

Stem-loop mmu-mir-543


Accession
MI0003519
Symbol
MGI: Mir543
Description
Mus musculus mmu-mir-543 precursor miRNA mir-329
Gene
family?
RF04295; mir-329

Literature search
15 open access papers mention mmu-mir-543
(167 sentences)

Sequence

22353 reads, 192 reads per million, 78 experiments
ugcuuaaugagAAGUUGCCCGCGUGUUUUUCGcuuuauaugugacgAAACAUUCGCGGUGCACUUCUUuuucagca
((((.((.(((((((.(((((((((((((((((.......)))).))))))..))))).))))))))).)).))))

Structure
    u  u       U  -     --      -    uu 
ugcu aa gagAAGU GC CCGCG  UGUUUU UCGc  u
|||| || ||||||| || |||||  |||||| ||||  a
acga uu UUCUUCA CG GGCGC  ACAAAg agug  u
    c  u       -  U     UU      c    ua 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr12: 109717258-109717333 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from mmu-mir-543
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-543-5p

Accession MIMAT0017207
Description Mus musculus mmu-miR-543-5p mature miRNA
Sequence 12 - AAGUUGCCCGCGUGUUUUUCG - 32
Evidence experimental
454 [6], Illumina [7]
Database links
Predicted targets

Mature mmu-miR-543-3p

Accession MIMAT0003168
Description Mus musculus mmu-miR-543-3p mature miRNA
Sequence 47 - AAACAUUCGCGGUGCACUUCUU - 68
Evidence experimental
cloned [1,4], MPSS [2], miRAP-cloned [3], Illumina [5,7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  5. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  6. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  7. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115