miRBase entry: lca-mir-23a

Stem-loop lca-mir-23a


Accession
MI0003043
Description
Lemur catta lca-mir-23a precursor miRNA


Sequence


ggccggcugggguuccuggggaugggauuugcuaccuaucacaaAUCACAUUGCCAGGGAUUUCCaaccgacc
((.(((.((((((((((((.((((.((((((..........)))))).)))).))))))).))))).))).))

Structure
  c   c     -       g    g      cuac 
gg cgg ugggg uuccugg gaug gauuug    c
|| ||| ||||| ||||||| |||| ||||||     
cc gcc aCCUU AGGGACC UUAC CUAaac    u
  a   a     U       G    A      acua 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Unknown

Database links

Mature lca-miR-23a

Accession MIMAT0002745
Description Lemur catta lca-miR-23a mature miRNA
Sequence 45 - AUCACAUUGCCAGGGAUUUCC - 65
Evidence not_experimental

References

  1. PubMed ID: 15652478
    Phylogenetic shadowing and computational identification of human microRNA genes
    "Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E"
    "Cell (2005) 120:21-24