miRBase entry: lca-mir-18

Stem-loop lca-mir-18


Accession
MI0002972
Description
Lemur catta lca-mir-18 precursor miRNA


Sequence


uguucUAAGGUGCAUCUAGUGCAGAUAgugaaguagauuagcaucuacugcccuaagugcuccuucuggca
((((..((((.((((.(((.((((.(((((..(.....)..)).))))))).))).)))).))))..))))

Structure
    cU    U    C   U    A   -  aa u 
uguu  AAGG GCAU UAG GCAG UAg ug  g a
||||  |||| |||| ||| |||| ||| ||  | g
acgg  uucc cgug auc cguc auc ac  u a
    uc    u    a   c    -   u  ga u 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Unknown

Database links

Mature lca-miR-18

Accession MIMAT0002667
Description Lemur catta lca-miR-18 mature miRNA
Sequence 6 - UAAGGUGCAUCUAGUGCAGAUA - 27
Evidence not_experimental

References

  1. PubMed ID: 15652478
    Phylogenetic shadowing and computational identification of human microRNA genes
    "Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E"
    "Cell (2005) 120:21-24