miRBase entry: mghv-mir-M1-4

Stem-loop mghv-mir-M1-4


Accession
MI0001672
Description
Mouse gammaherpesvirus 68 mghv-mir-M1-4 precursor miRNA


Sequence


cgagcccugaccaUCGAGGAGCACGUGUUAUUCUAgaccucucuuccagcuaAGAUAGCAUGUGCCGUCCUCUUUguuucccaagucaguauuc
.(((..(((((((..(((((((((((((((((.(((.............))).))))))))))))..)))))..))........)))))..)))

Structure
c   cc     --------  UC     --            C   accuc 
 gag  cugac        ca  GAGGA  GCACGUGUUAUU UAg     u
 |||  |||||        ||  |||||  |||||||||||| |||     c
 cuu  gacug        gU  CUCCU  CGUGUACGAUAG auc     u
-   au     aacccuuu  UU     GC            A   gaccu 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
U97553: 956-1049 [+]
Clustered miRNAs
14 other miRNAs are < 10 kb from mghv-mir-M1-4
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mghv-miR-M1-4-5p

Accession MIMAT0001567
Description Mouse gammaherpesvirus 68 mghv-miR-M1-4-5p mature miRNA
Sequence 14 - UCGAGGAGCACGUGUUAUUCUA - 35
Evidence experimental
cloned [1-3], 454 [4], Illumina [5]

Mature mghv-miR-M1-4-3p

Accession MIMAT0017188
Description Mouse gammaherpesvirus 68 mghv-miR-M1-4-3p mature miRNA
Sequence 53 - AGAUAGCAUGUGCCGUCCUCUUU - 75
Evidence experimental
454 [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  3. PubMed ID: 15782219
    Identification of microRNAs of the herpesvirus family
    "Pfeffer S, Sewer A, Lagos-Quintana M, Sheridan R, Sander C, Grasser FA, van Dyk LF, Ho CK, Shuman S, Chien M, Russo JJ, Ju J, Randall G, Lindenbach BD, Rice CM, Simon V, Ho DD, Zavolan M, Tuschl T"
    "Nat Methods (2005) 2:269-276

  4. PubMed ID: 19948768
    Mature and functional viral miRNAs transcribed from novel RNA polymerase III promoters
    "Diebel KW, Smith AL, van Dyk LF"
    "RNA (2010) 16:170-185

  5. PubMed ID: 20660200
    Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts
    "Reese TA, Xia J, Johnson LS, Zhou X, Zhang W, Virgin HW"
    "J Virol (2010) 84:10344-10353