miRBase entry: ame-mir-9b

Stem-loop ame-mir-9b


Accession
MI0001597
Description
Apis mellifera ame-mir-9b precursor miRNA
Gene family
MIPF0000014; mir-9

Literature search
1 open access papers mention ame-mir-9b
(2 sentences)

Sequence

uaaugcuagugcucuuuGCUUUGGUAAUCUAGCUUUAUGAuccuuaauuaaaaucauagagcuauauuaccaaaguaaaggcaaaagcuuug
....(((..(((.(((((((((((((((.((((((((((((...........)))))))))))).))))))))))))))))))..)))....

Structure
uaau   ag   u               C            ccuu 
    gcu  ugc cuuuGCUUUGGUAAU UAGCUUUAUGAu    a
    |||  ||| ||||||||||||||| ||||||||||||    a
    cga  acg gaaaugaaaccauua aucgagauacua    u
guuu   aa   -               u            aaau 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
CM000066.5: 7887633-7887724 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from ame-mir-9b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ame-miR-9b-5p

Accession MIMAT0001492
Description Apis mellifera ame-miR-9b-5p mature miRNA
Sequence 18 - GCUUUGGUAAUCUAGCUUUAUGA - 40
Evidence experimental
RTPCR [1-2], Illumina [3-4]

References

  1. PubMed ID: 17543122
    Computational and transcriptional evidence for microRNAs in the honey bee genome
    Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG
    Genome Biol (2007) 8:R97

  2. PubMed ID: 22409512
    Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome
    "Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y"
    "Genes Brain Behav (2012) 11:660-670

  3. PubMed ID: 20491979
    Correlated expression patterns of microRNA genes with age-dependent behavioural changes in honeybee
    "Behura SK, Whitfield CW"
    "Insect Mol Biol (2010) 19:431-439

  4. PubMed ID: 26853694
    MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)
    "Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL"
    "Insect Mol Biol (2016) 25:216-226