miRBase entry: mmu-mir-410

Stem-loop mmu-mir-410


Accession
MI0001161
Symbol
MGI: Mir410
Description
Mus musculus mmu-mir-410 precursor miRNA

Literature search
21 open access papers mention mmu-mir-410
(264 sentences)

Sequence

179229 reads, 710 reads per million, 81 experiments
ggguacuugaggagAGGUUGUCUGUGAUGAGUUCGcuuuauuaaugacgAAUAUAACACAGAUGGCCUGUuuucaauacca
.((((.(((((((.((((((((((((.((.((((((.........).))))).)).)))))))))))).))))))))))).

Structure
g    c       g            A  A     - uuu 
 ggua uugagga AGGUUGUCUGUG UG GUUCG c   a
 |||| ||||||| |||||||||||| || ||||| |   u
 ccau aacuuuU UCCGGUAGACAC AU UAAgc g   u
a    -       G            A  A     a uaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr12: 109743715-109743795 [+]
Clustered miRNAs
13 other miRNAs are < 10 kb from mmu-mir-410
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-410-5p

Accession MIMAT0017172
Description Mus musculus mmu-miR-410-5p mature miRNA
Sequence 15 - AGGUUGUCUGUGAUGAGUUCG - 35
Evidence experimental
454 [6], Illumina [7]
Database links
Predicted targets

Mature mmu-miR-410-3p

Accession MIMAT0001091
Description Mus musculus mmu-miR-410-3p mature miRNA
Sequence 50 - AAUAUAACACAGAUGGCCUGU - 70
Evidence experimental
Northern [1,3], PCR [1], cloned [2-4], insitu [3], Illumina [5,7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  5. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748

  6. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  7. PubMed ID: 16566924
    Identification of new central nervous system specific mouse microRNAs
    "Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T"
    "FEBS Lett (2006) 580:2195-2200