miRBase entry: ebv-mir-BART1

Stem-loop ebv-mir-BART1


Accession
MI0001067
Description
Epstein Barr virus ebv-mir-BART1 precursor miRNA
Gene family
MIPF0000325; mir-BART1


Sequence

gggggUCUUAGUGGAAGUGACGUGCUGUGaauacagguccaUAGCACCGCUAUCCACUAUGUCucgcccg
(((.(...(((((((((((..((((((((.((....)).)))))))))))).))))))).....).))).

Structure
-   g --UCU       -    AC        a  a 
 ggg g     UAGUGGA AGUG  GUGCUGUG au c
 ||| |     ||||||| ||||  |||||||| ||  
 ccc c     AUCACCU UCGC  CACGAUac ug a
g   g uCUGU       A    --        c  g 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Pfeffer et al. cloned 5 miRNAs from a Burkitt's lymphoma cell line (BL41) infected with the B95-8 strain of Epstein-Barr virus [1]. They were all confirmed by Northern blot. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
HHV507799: 139346-139415 [+]
Clustered miRNAs
20 other miRNAs are < 10 kb from ebv-mir-BART1
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART1-5p

Accession MIMAT0000999
Description Epstein Barr virus ebv-miR-BART1-5p mature miRNA
Sequence 6 - UCUUAGUGGAAGUGACGUGCUGUG - 29
Evidence experimental
cloned [1,3], Northern [1]

Mature ebv-miR-BART1-3p

Accession MIMAT0003390
Description Epstein Barr virus ebv-miR-BART1-3p mature miRNA
Sequence 42 - UAGCACCGCUAUCCACUAUGUC - 63
Evidence experimental
cloned [2-3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15118162
    Identification of virus-encoded microRNAs
    "Pfeffer S, Zavolan M, Grasser FA, Chien M, Russo JJ, Ju J, John B, Enright AJ, Marks D, Sander C, Tuschl T"
    "Science (2004) 304:734-736

  3. PubMed ID: 16557291
    Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
    Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
    PLoS Pathog (2006) 2:e23