Stem-loop rno-mir-196a

Accession

MI0000940

Description

Rattus norvegicus rno-mir-196a precursor miRNA

Literature search

11 open access papers mention rno-mir-196a
(22 sentences)

Sequence

51670 reads, 84 reads per million, 248 experiments

uguuugcucagcugaucuguggcuUAGGUAGUUUCAUGUUGUUGGGauugaguuuugaacUCGGCAACAAGAAACUGCCUGAguuacaucagucgguuuucgucgagggc
.....(((((((((((.((((((((((((((((((.((((((((((.((........)))))))))))).))))))))))))))))))...)))))))........))))

Structure

uguuu    --------       --c                  A          a  gag 
     gcuc        agcugau   uguggcuUAGGUAGUUUC UGUUGUUGGG uu   u
     ||||        |||||||   |||||||||||||||||| |||||||||| ||    
     cggg        uuggcug   acauugAGUCCGUCAAAG ACAACGGCUc aa   u
-----    agcugcuu       acu                  A          -  guu 

Annotation confidence High

Comments

Yekta et al. report that miR-196 miRNAs are expressed from HOX gene clusters in mammals, and that HOX genes in these clusters are targets of miR-196. Indeed, HOXB8 mRNA was shown to be a natural target for miR-196-directed cleavage through a perfectly complementary miR-target site. Other HOX genes have imperfect miR-196 complementary sites indicative of regulation by translational repression [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr7: 144584235-144584344 [+]

Mature rno-miR-196a-5p

• Accession: MIMAT0000871
• Description: Rattus norvegicus rno-miR-196a-5p mature miRNA
• Sequence: 25 - UAGGUAGUUUCAUGUUGUUGGG - 46
• Evidence: experimental ; cloned [1,3], SOLiD [4]

Mature rno-miR-196a-3p

• Accession: MIMAT0004737
• Description: Rattus norvegicus rno-miR-196a-3p mature miRNA
• Sequence: 61 - UCGGCAACAAGAAACUGCCUGA - 82
• Evidence: experimental ; cloned [3], SOLiD [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 15105502
   MicroRNA-directed cleavage of HOXB8 mRNA
   "Yekta S, Shih IH, Bartel DP"
   "Science (2004) 304:594-596


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249