Stem-loop rno-mir-191a

Accession

MI0000934

Description

Rattus norvegicus rno-mir-191a precursor miRNA

Literature search

24 open access papers mention rno-mir-191a
(58 sentences)

Sequence

13586158 reads, 13128 reads per million, 510 experiments

ggcuggacagcgggCAACGGAAUCCCAAAAGCAGCUGuugucuccagagcauuccaGCUGCACUUGGAUUUCGUUCCCugcucuccugccu
(((.(((.((((((.((((((((((.((..(((((((.(((.......)))...)))))))..)))))))))))).)))))).))).))).

Structure

-   u   c      C          C  AA       --u   cu 
 ggc gga agcggg AACGGAAUCC AA  GCAGCUG   ugu  c
 ||| ||| |||||| |||||||||| ||  |||||||   |||  c
 ccg ccu ucguCC UUGCUUUAGG UU  CGUCGac   acg  a
u   u   c      C          -  CA       cuu   ag 

Annotation confidence High

Genome context

chr8: 117354364-117354454 [+]

Clustered miRNAs

2 other miRNAs are < 10 kb from rno-mir-191a

Mature rno-miR-191a-5p

• Accession: MIMAT0000866
• Description: Rattus norvegicus rno-miR-191a-5p mature miRNA
• Sequence: 15 - CAACGGAAUCCCAAAAGCAGCUG - 37
• Evidence: experimental ; cloned [1-4], Northern [1,3], SOLiD [5]

Mature rno-miR-191a-3p

• Accession: MIMAT0017146
• Description: Rattus norvegicus rno-miR-191a-3p mature miRNA
• Sequence: 57 - GCUGCACUUGGAUUUCGUUCCC - 78
• Evidence: experimental ; SOLiD [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


5. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68