miRBase entry: rno-mir-99b

Stem-loop rno-mir-99b


Accession
MI0000884
Description
Rattus norvegicus rno-mir-99b precursor miRNA

Literature search
13 open access papers mention rno-mir-99b
(51 sentences)

Sequence

4687616 reads, 3509 reads per million, 504 experiments
ggcaccCACCCGUAGAACCGACCUUGCGgggccuucgccgcacaCAAGCUCGUGUCUGUGGGUCCGuguc
(((((..(((((((((..(((.((((.(.(((....))).)...)))).)))..)))))))))..)))))

Structure
     cC         AC   C    --C g   c 
ggcac  ACCCGUAGA  CGA CUUG   G ggc u
|||||  |||||||||  ||| ||||   | |||  
cuguG  UGGGUGUCU  GCU GAAC   c ccg u
     CC         GU   C    aca g   c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 59704216-59704285 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from rno-mir-99b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-99b-5p

Accession MIMAT0000821
Description Rattus norvegicus rno-miR-99b-5p mature miRNA
Sequence 7 - CACCCGUAGAACCGACCUUGCG - 28
Evidence experimental
cloned [1-4], Northern [1,3], SOLiD [5]

Mature rno-miR-99b-3p

Accession MIMAT0004725
Description Rattus norvegicus rno-miR-99b-3p mature miRNA
Sequence 45 - CAAGCUCGUGUCUGUGGGUCCG - 66
Evidence experimental
cloned [4], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68