miRBase entry: rno-mir-99a

Stem-loop rno-mir-99a


Accession
MI0000883
Description
Rattus norvegicus rno-mir-99a precursor miRNA

Literature search
22 open access papers mention rno-mir-99a
(58 sentences)

Sequence

810424 reads, 799 reads per million, 491 experiments
cccauuggcauaAACCCGUAGAUCCGAUCUUGUGgugaaguggaccgcaCAAGCUCGUUUCUAUGGGUCUGuggcagugug
..(((((.((((.(((((((((..(((.((((((.((........)))))))).)))..))))))))).)))).)))))..

Structure
cc     g    A         UC   U      g  aag 
  cauug caua ACCCGUAGA  CGA CUUGUG ug   u
  ||||| |||| |||||||||  ||| |||||| ||    
  gugac guGU UGGGUAUCU  GCU GAACac gc   g
gu     g    C         UU   C      -  cag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr11: 16052153-16052233 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-99a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-99a-5p

Accession MIMAT0000820
Description Rattus norvegicus rno-miR-99a-5p mature miRNA
Sequence 13 - AACCCGUAGAUCCGAUCUUGUG - 34
Evidence experimental
cloned [1-5], SOLiD [6]

Mature rno-miR-99a-3p

Accession MIMAT0004724
Description Rattus norvegicus rno-miR-99a-3p mature miRNA
Sequence 50 - CAAGCUCGUUUCUAUGGGUCUG - 71
Evidence experimental
cloned [4], SOLiD [6]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  6. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714