miRBase entry: rno-mir-18a

Stem-loop rno-mir-18a


Accession
MI0000846
Description
Rattus norvegicus rno-mir-18a precursor miRNA

Literature search
32 open access papers mention rno-mir-18a
(83 sentences)

Sequence

9244 reads, 12 reads per million, 464 experiments
ugcgugcuuuuuguucUAAGGUGCAUCUAGUGCAGAUAGugaaguagacuagcaucuACUGCCCUAAGUGCUCCUUCUggcauaagaaguuauguc
.(((((((((((((.((((((.((((.(((.((((.(((((...........)).))))))).))).)))).)))..))).)))))))).))))).

Structure
u     -        u   --   U    C   U    A   -  aagu 
 gcgug cuuuuugu cUA  AGG GCAU UAG GCAG UAG ug    a
 ||||| |||||||| |||  ||| |||| ||| |||| ||| ||    g
 uguau gaagaaua ggU  UCC CGUG AUC CGUC Auc ac    a
c     u        c   CU   U    A   C    -   u  gauc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA was predicted based on homology to a verified miRNA from mouse [1]. Its expression in rat was later verified by cloning [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr15: 100180015-100180110 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from rno-mir-18a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-18a-5p

Accession MIMAT0000787
Description Rattus norvegicus rno-miR-18a-5p mature miRNA
Sequence 17 - UAAGGUGCAUCUAGUGCAGAUAG - 39
Evidence experimental
cloned [2-3], SOLiD [4]

Mature rno-miR-18a-3p

Accession MIMAT0017095
Description Rattus norvegicus rno-miR-18a-3p mature miRNA
Sequence 58 - ACUGCCCUAAGUGCUCCUUCU - 78
Evidence experimental
SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249