Stem-loop mmu-mir-7a-2

Accession

MI0000729

Description

Mus musculus mmu-mir-7a-2 precursor miRNA

Literature search

135 open access papers mention mmu-mir-7a-2
(1285 sentences)

Sequence

141707 reads, 793 reads per million, 107 experiments

ggucgggccagccccguuUGGAAGACUAGUGAUUUUGUUGUugugucucuguauccaaCAACAAGUCCCAGUCUGCCACAuggugcuggucauuuca
((...(((((((.((((.(((.(((((.(.(((((.(((((((.((......)).))))))))))))).))))).))).)))).)))))))...)).

Structure

-  ucg       c    u   A     A U     U       u  cu 
 gg   ggccagc ccgu UGG AGACU G GAUUU GUUGUug gu  c
 ||   ||||||| |||| ||| ||||| | ||||| ||||||| ||   
 cu   cuggucg gguA ACC UCUGA C CUGAA CAACaac ua  u
a  uua       u    C   G     C -     -       c  ug 

Annotation confidence High

Comments

miR-7a (previously named miR-7) was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

chr7: 78888277-78888373 [+]

Mature mmu-miR-7a-5p

• Accession: MIMAT0000677
• Description: Mus musculus mmu-miR-7a-5p mature miRNA
• Sequence: 19 - UGGAAGACUAGUGAUUUUGUUGU - 41
• Evidence: experimental ; cloned [2,4], Illumina [5-6]

Mature mmu-miR-7a-2-3p

• Accession: MIMAT0017070
• Description: Mus musculus mmu-miR-7a-2-3p mature miRNA
• Sequence: 59 - CAACAAGUCCCAGUCUGCCACA - 80
• Evidence: experimental ; Illumina [6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12624257
   Vertebrate microRNA genes
   "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
   "Science (2003) 299:1540


3. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 15634332
   New human and mouse microRNA genes found by homology search
   "Weber MJ"
   "FEBS J (2005) 272:59-73