miRBase entry: mmu-mir-7a-1

Stem-loop mmu-mir-7a-1


Accession
MI0000728
Symbol
MGI: Mir7-1
Description
Mus musculus mmu-mir-7a-1 precursor miRNA

Literature search
135 open access papers mention mmu-mir-7a-1
(1287 sentences)

Sequence

147676 reads, 1126 reads per million, 105 experiments
uuggauguuggccuaguucugugUGGAAGACUAGUGAUUUUGUUGUuuuuagauaacuaaaacgaCAACAAAUCACAGUCUGCCAUAuggcacaggccaccucuacag
.((((.((.(((((.((.((((((((.(((((.(((((((.(((((((((((....)))))..)))))))))))))))))).)))))))).))))))))).))))...

Structure
--u    u  u     a  u        A     A       U      --     a 
   ugga gu ggccu gu cugugUGG AGACU GUGAUUU GUUGUu  uuuag u
   |||| || ||||| || |||||||| ||||| ||||||| ||||||  |||||  
   aucu ca ccgga ca gguAUACC UCUGA CACUAAA CAACag  aaauc a
gac    c  -     -  c        G     -       -      ca     a 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-7a (previously named miR-7) was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr13: 58392779-58392886 [-]

Database links

Mature mmu-miR-7a-5p

Accession MIMAT0000677
Description Mus musculus mmu-miR-7a-5p mature miRNA
Sequence 24 - UGGAAGACUAGUGAUUUUGUUGU - 46
Evidence experimental
cloned [2,4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-7a-1-3p

Accession MIMAT0004670
Description Mus musculus mmu-miR-7a-1-3p mature miRNA
Sequence 66 - CAACAAAUCACAGUCUGCCAUA - 87
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73